Prev. |  Human A to Z list >  A >  ATOH7 > 

NRCD Human cDNA Clone - RBdS081C04

Catalog Number HKR432452
Clone Name RBdS081C04
Clone info. Plasmid clone of human ATOH7 cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG
Sequence, submitted(2) AB593109 link 01
 
Sequence, refered NM_145178.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ATOH7 (NCBI Gene 220202) finder other clones with this gene.
Synonyms Math5|bHLHa13
Protein Name atonal homolog 7 (Drosophila)
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR432452 RBdS081C04 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl