Prev. |  Human A to Z list >  A >  ATOH7 > 

NRCD Human cDNA Clone - RBd08C12

Catalog Number HKR363260
Clone Name RBd08C12
Clone info. Plasmid clone of human ATOH7 cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG
Sequence, submitted(2) AB593108 link 01
 
Sequence, refered NM_145178.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ATOH7 (NCBI Gene 220202) finder other clones with this gene.
Synonyms Math5|bHLHa13
Protein Name atonal homolog 7 (Drosophila)
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR363260 RBd08C12 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl