Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06388

HP ID(1) HP06388
Gene ID(2) 55288
Gene Symbol finder RHOT1
Protein Name ras homolog gene family, member T1
RefSeq NM_018307.3
Length of RefSeq (bp) 3089
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.655325

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi71F08 pGCAP10 GACAGCCCGCTGGGCCGGAGGAGGCGGAGCTGGCGCTGTCCCGGCTCTCTTGCGGGGAAG
ARiS198H23 pGCAP10
RBb59C02 pGCAP1 TGGGGCGCTGTCCCGGCTCTCTTGCGGGGAAGCAACTGAGGGGGCGGCGCGGCGGGCCCC
RBdS040O15 pGCAP10 GAGAGGCTGGCAGGTGGCGCCGTGGGGTGGGTGCTCCTGGTGAGAGGAGTCCACTCCGTG
RBdS156E23 pGCAP10 GGCTCCTGGTGAGAGGAGTCCACTCCGTGCGTGCGGGCGGAGGCCGGCCCCCGAGAGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl