Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156E23

Clone ID RBdS156E23
HP ID HP06388
Gene ID 55288
Gene Symbol RHOT1
Protein Name ras homolog gene family, member T1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018307.3
Length of RefSeq (bp) 3089
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.655325
5'-terminal sequence GGCTCCTGGTGAGAGGAGTCCACTCCGTGCGTGCGGGCGGAGGCCGGCCCCCGAGAGCCG
2011.08.28