Prev. |  KEGG KO K07870 > 

RIKEN DNA Bank Human Resource - RHOT1

Gene ID NCBI Gene 55288 |  KEGG hsa:55288
Gene Symbol RHOT1
Protein Name ras homolog family member T1
Synonyms ARHT1|MIRO-1|MIRO1
Ortholog resources KEGG ortholog (KEGG orthology K07870) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006004 IRAK015A04 pCMV-SPORT6 BC015698 NM_001033567 Partial/var
HGX032803 IRAK082A03 pCMV-SPORT6 BC041114 NM_001033567
HGX044189 IRAK110H21 pCMV-SPORT6 BC051818 NM_001033567
HGY053481 IRAK133L17 pBluescript BC060781 NM_001033567
HGY067002 IRAK167I10 pBluescriptR BC068463 NM_001033567

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR188528 ARi71F08 pGCAP10 NM_018307.3  
GACAGCCCGCTGGGCCGGAGGAGGCGGAGCTGGCGCTGTCCCGGCTCTCTTGCGGGGAAG
HKR279391 ARiS198H23 pGCAP10 NM_018307.3  
HKR343650 RBb59C02 pGCAP1 NM_018307.3  
TGGGGCGCTGTCCCGGCTCTCTTGCGGGGAAGCAACTGAGGGGGCGGCGCGGCGGGCCCC
HKR416351 RBdS040O15 pGCAP10 NM_018307.3  
GAGAGGCTGGCAGGTGGCGCCGTGGGGTGGGTGCTCCTGGTGAGAGGAGTCCACTCCGTG
HKR462519 RBdS156E23 pGCAP10 NM_018307.3  
GGCTCCTGGTGAGAGGAGTCCACTCCGTGCGTGCGGGCGGAGGCCGGCCCCCGAGAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl