Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06281

HP ID(1) HP06281
Gene ID(2) 6251
Gene Symbol finder RSU1
Protein Name Ras suppressor protein 1
RefSeq NM_012425.3
Length of RefSeq (bp) 3769
Chromosome 10p13
Reference DDBJ accession
UniGene Hs.524161

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi09F08 pGCAP10 GGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGC
ARi12F02 pGCAP10 GCTTGCGGGCTCCTGGCCGTTGTGCCGAGACCTGTGNGTTCGCTGTTCAATGGGAGTGTT
ARiS020F02 pGCAP10 GAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCT
ARiS049I08 pGCAP10 GGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCT
ARiS085P01 pGCAP10
RBdS154K14 pGCAP10 GGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGC
RBdS154N07 pGCAP10 GGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl