Prev. | 

RIKEN DNA Bank Human Resource - RSU1

Gene ID NCBI Gene 6251 |  KEGG hsa:6251
Gene Symbol RSU1
Protein Name Ras suppressor protein 1
Synonyms RSP-1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005486 IRAK013L22 pCMV-SPORT6 BC008691 NM_152724 Full
HGY088555 IRAL021G11 pDNR-LIB BC005993 NM_152724 Full
HGY093348 IRAL033G04 pOTB7 BC015644 NM_152724 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163728 ARi09F08 pGCAP10 NM_012425.3  
GGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGC
HKR164922 ARi12F02 pGCAP10 NM_012425.3  
GCTTGCGGGCTCCTGGCCGTTGTGCCGAGACCTGTGNGTTCGCTGTTCAATGGGAGTGTT
HKR208122 ARiS020F02 pGCAP10 NM_012425.3  
GAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCT
HKR219800 ARiS049I08 pGCAP10 NM_012425.3  
GGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCT
HKR234361 ARiS085P01 pGCAP10 NM_012425.3  
HKR461854 RBdS154K14 pGCAP10 NM_012425.3  
GGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGC
HKR461919 RBdS154N07 pGCAP10 NM_012425.3  
GGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl