Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154N07

Clone ID RBdS154N07
HP ID HP06281
Gene ID 6251
Gene Symbol RSU1
Protein Name Ras suppressor protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_012425.3
Length of RefSeq (bp) 3769
Chromosome 10p13
Reference DDBJ accession
UniGene Hs.524161
5'-terminal sequence GGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGC
2011.08.28