Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06193

HP ID(1) HP06193
Gene ID(2) 84839
Gene Symbol finder RAX2
Protein Name retina and anterior neural fold homeobox 2
RefSeq NM_032753.3
Length of RefSeq (bp) 2190
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.532691

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb42C11 pGCAP1 GAGCCCCGACCTGGCTCGGCTCCGGCAGGGCCAGGCCACAGCAGACGCAGCGCCAGGCCC
RBd24E05 pGCAP10 GAGACGCTGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGGCTGCC
RBd27E08 pGCAP10 AAAGAGACGCAGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGGCT
RBd71F07 pGCAP10 GACAGCAGACGCAGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGG
RBdS075L22 pGCAP10 GAGACGCAGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGGCTGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl