Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075L22

Clone ID RBdS075L22
HP ID HP06193
Gene ID 84839
Gene Symbol RAX2
Protein Name retina and anterior neural fold homeobox 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032753.3
Length of RefSeq (bp) 2190
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.532691
5'-terminal sequence GAGACGCAGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGGCTGCC
2011.08.28