Prev. |  KEGG KO K09333 > 

RIKEN DNA Bank Human Resource - RAX2

Gene ID NCBI Gene 84839 |  KEGG hsa:84839
Gene Symbol RAX2
Protein Name retina and anterior neural fold homeobox 2
Synonyms ARMD6|CORD11|QRX|RAXL1
Ortholog resources KEGG ortholog (KEGG orthology K09333) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027703 IRAK069E07 pCMV-SPORT6 BC032512 NM_032753 Full
HGY089057 IRAL022K17 pOTB7 BC007284 NM_032753 Full
HGY096145 IRAL040G01 pOTB7 BC018709 NM_032753

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336859 RBb42C11 pGCAP1 NM_032753.3  
GAGCCCCGACCTGGCTCGGCTCCGGCAGGGCCAGGCCACAGCAGACGCAGCGCCAGGCCC
HKR369701 RBd24E05 pGCAP10 NM_032753.3  
GAGACGCTGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGGCTGCC
HKR370904 RBd27E08 pGCAP10 NM_032753.3  
AAAGAGACGCAGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGGCT
HKR388527 RBd71F07 pGCAP10 NM_032753.3  
GACAGCAGACGCAGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGG
HKR430286 RBdS075L22 pGCAP10 NM_032753.3  
GAGACGCAGCGCCAGGCCCGCTGGGGCAGGTGTCCCGTGGAAATCGACGGAGGGGCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl