Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06170

HP ID(1) HP06170
Gene ID(2) 5983
Gene Symbol finder RFC3
Protein Name replication factor C (activator 1) 3, 38kDa
RefSeq NM_002915.3
Length of RefSeq (bp) 2396
Chromosome 13q12.3-q13
Reference DDBJ accession
UniGene Hs.115474

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb65A06 pGCAP1 AAAACTTGTCTCTGCGTTGTGGGGAGGACGCGCGCTCGCGCGGGATTTTCAAGCGTAGGC
RBdS070P17 pGCAP10 GGCGCTCGCGCGGGATTTTCAAGCGTAGGCCCCCGGGAACTCGAGCTGCCATGAGCCTCT
RBdS156A01 pGCAP10 GGGNNNCTCGAGCTGCCCTGAGCCTCTGGGNGGACAAGTATCGGCCCTGCTCCTTGGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl