Prev. |  Human A to Z list >  R >  RFC3 > 

NRCD Human cDNA Clone - RBb65A06

Catalog Number HKR346006
Clone Name RBb65A06
Clone info. Plasmid clone of human RFC3 cDNA with SV40 promoter
Vector plasmidClick for information pGCAP1
5'-terminal sequence(1) AAAACTTGTCTCTGCGTTGTGGGGAGGACGCGCGCTCGCGCGGGATTTTCAAGCGTAGGC
Sequence, submitted(2) Not available.
 
Sequence, refered NM_002915.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RFC3 (NCBI Gene 5983) finder other clone of RFC3 in our bank
Synonyms RFC38
Protein Name replication factor C (activator 1) 3, 38kDa
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Availability
HKR346006 RBb65A06 This clone has been withdrawn.

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2017.07.03

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl