Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070P17

Clone ID RBdS070P17
HP ID HP06170
Gene ID 5983
Gene Symbol RFC3
Protein Name replication factor C (activator 1) 3, 38kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002915.3
Length of RefSeq (bp) 2396
Chromosome 13q12.3-q13
Reference DDBJ accession
UniGene Hs.115474
5'-terminal sequence GGCGCTCGCGCGGGATTTTCAAGCGTAGGCCCCCGGGAACTCGAGCTGCCATGAGCCTCT
2011.08.28