Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06076

HP ID(1) HP06076
Gene ID(2) 5885
Gene Symbol finder RAD21
Protein Name RAD21 homolog (S. pombe)
RefSeq NM_006265.2
Length of RefSeq (bp) 3773
Chromosome 8q24
Reference DDBJ accession
UniGene Hs.81848

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049M19 pGCAP10 ATCTTGTTTGTTTGAGTGAATCGGAAAGGAGGCGCCGGCTGTGGCGGCGGCGGGAGCTGC
ARiS161A16 pGCAP10 GGGCAGCCATCTTGTTTGTTTGAGTGAATCGGAAAGGAGGCGCCGGCTGTGGCGGCGGCG
RBdS156J08 pGCAP10 GCCCCTTCGCCCCGGGCCCGCCCTCGGCCCGGACCCATGCAGCTTGGGCCCGCATCATCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl