Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156J08

Clone ID RBdS156J08
HP ID HP06076
Gene ID 5885
Gene Symbol RAD21
Protein Name RAD21 homolog (S. pombe)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006265.2
Length of RefSeq (bp) 3773
Chromosome 8q24
Reference DDBJ accession
UniGene Hs.81848
5'-terminal sequence GCCCCTTCGCCCCGGGCCCGCCCTCGGCCCGGACCCATGCAGCTTGGGCCCGCATCATCG
2011.08.28