Prev. |  KEGG KO K06670 > 

RIKEN DNA Bank Human Resource - RAD21

Gene ID NCBI Gene 5885 |  KEGG hsa:5885
Gene Symbol RAD21
Protein Name RAD21 cohesin complex component
Synonyms CDLS4|HR21|HRAD21|MCD1|NXP1|SCC1|hHR21
Ortholog resources KEGG ortholog (KEGG orthology K06670) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039415 IRAK098I23 pCMV-SPORT6 BC050381 NM_006265 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010642 W01A026K02 pENTR-TOPO IRAK098I23 BC050381 NM_006265 done
HGE010644 W01A026K04 pENTR-TOPO IRAK098I23 BC050381 NM_006265  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219907 ARiS049M19 pGCAP10 NM_006265.2  
ATCTTGTTTGTTTGAGTGAATCGGAAAGGAGGCGCCGGCTGTGGCGGCGGCGGGAGCTGC
HKR264416 ARiS161A16 pGCAP10 NM_006265.2  
GGGCAGCCATCTTGTTTGTTTGAGTGAATCGGAAAGGAGGCGCCGGCTGTGGCGGCGGCG
HKR462624 RBdS156J08 pGCAP10 NM_006265.2  
GCCCCTTCGCCCCGGGCCCGCCCTCGGCCCGGACCCATGCAGCTTGGGCCCGCATCATCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl