Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05756

HP ID(1) HP05756
Gene ID(2) 5887
Gene Symbol finder RAD23B
Protein Name RAD23 homolog B (S. cerevisiae)
RefSeq NM_002874.3
Length of RefSeq (bp) 4130
Chromosome 9q31.2
Reference DDBJ accession
UniGene Hs.521640

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd01A07 pGCAP10 GGGCCAGCACCCGGCGCAGGCCCGGCAGCCGAGCTGCGCGGCGGCACCATGCAGGTCACC
RBd90F09 pGCAP10 GAGACCCCGCCCAGCGGCCAGCACCCGGCGCAGGCCCGGCAGCCGAGCTGCGCGGCGGCA
RBdS014L24 pGCAP10 GAGCCGAGCTGCGCGGCGGCACCATGCAGGTCACCCTGAAGACCCTCCAGCAGCAGACCT
RBdS132K01 pGCAP10 GGGGGCACGTCTCGGCGAGTCACGATGATGGCGGCCACCATCCTGTGGTGAGCTAGCGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl