Prev. |  KEGG KO K10839 > 

RIKEN DNA Bank Human Resource - RAD23B

Gene ID NCBI Gene 5887 |  KEGG hsa:5887
Gene Symbol RAD23B
Protein Name RAD23 homolog B, nucleotide excision repair protein
Synonyms HHR23B|HR23B|P58
Featured content DNA repair (human)
Ortholog resource in our bank

  RAD23B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005962 IRAK014P02 pCMV-SPORT6 BC020973 NM_002874 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR360407 RBd01A07 pGCAP10 NM_002874.3  
GGGCCAGCACCCGGCGCAGGCCCGGCAGCCGAGCTGCGCGGCGGCACCATGCAGGTCACC
HKR396129 RBd90F09 pGCAP10 NM_002874.3  
GAGACCCCGCCCAGCGGCCAGCACCCGGCGCAGGCCCGGCAGCCGAGCTGCGCGGCGGCA
HKR405888 RBdS014L24 pGCAP10 NM_002874.3  
GAGCCGAGCTGCGCGGCGGCACCATGCAGGTCACCCTGAAGACCCTCCAGCAGCAGACCT
HKR453041 RBdS132K01 pGCAP10 NM_002874.3  
GGGGGCACGTCTCGGCGAGTCACGATGATGGCGGCCACCATCCTGTGGTGAGCTAGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl