Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014L24

Clone ID RBdS014L24
HP ID HP05756
Gene ID 5887
Gene Symbol RAD23B
Protein Name RAD23 homolog B (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002874.3
Length of RefSeq (bp) 4130
Chromosome 9q31.2
Reference DDBJ accession
UniGene Hs.521640
5'-terminal sequence GAGCCGAGCTGCGCGGCGGCACCATGCAGGTCACCCTGAAGACCCTCCAGCAGCAGACCT
2011.08.28