Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05509

HP ID(1) HP05509
Gene ID(2) 84268
Gene Symbol finder RPAIN
Protein Name RPA interacting protein
RefSeq NM_001033002.2
Length of RefSeq (bp) 1535
Chromosome 17p13.2
Reference DDBJ accession
UniGene Hs.462086

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf01H12 pKA1U5 GCTCCAGGGCAACGGGGTCTTGCTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCG
ARi60B03 pGCAP10 GGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCACGCCGCTCC
ARiS008G03 pGCAP10 GGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCC
ARiS150H07 pGCAP10 GGTGGCTTTGTCTCCCNCNAANAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCC
RBb16G10 pKA1U5 ATCCTGTGCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCC
RBb23F01 pGCAP1 GGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCCCT
RBb25F09 pGCAP1 GGCCTCCAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGT
RBb38D11 pGCAP1 GGGCTCTGTGCGCGCCTCCGGGGAACGGGCTCTTGTGGCTTTGATCTCCCGCGAAAAGGA
RBd16B09 pGCAP10 GGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCC
RBd54F05 pGCAP10 TTTCGGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCG
RBd55F10 pGCAP10 GGCCTCCAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGANGANATGGCGGAGTCGT
RBd57G08 pGCAP10 GAGGGGGTCTGTGCGCGCCTCCAGGGAACGGGTCTTGTGGCNTNNNCTCCCGCGAAGAGG
RBd61A11 pGCAP10 GGTGCAAAGATGTAAGGTTTTTTGAAACTTGAAATGCATTAATAAATAGACGATTAAATC
RBd62F11 pGCAP10 GGGCGGCTTTCCCGCCCCCCCCGAGGAGATGGNGCACTCCTCCAGGTCTACCCACCTCTC
RBd71C03 pGCAP10 GCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGC
RBd96H06 pGCAP10 GGCCTCCAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGT
RBdS051B21 pGCAP10 GAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl