Prev. | 

RIKEN DNA Bank Human Resource - RPAIN

Gene ID NCBI Gene 84268 |  KEGG hsa:84268
Gene Symbol RPAIN
Protein Name RPA interacting protein
Synonyms HRIP|RIP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX037523 IRAK093N11 pCMV-SPORT6 BC046349 NM_032308 Partial
HGX044077 IRAK110D05 pCMV-SPORT6 BC051849 NM_001033002 Full
HGY083863 IRAL009K23 pOTB7 BC004451 NM_032308 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR080580 ARf01H12 pKA1U5 NM_001033002.2  
GCTCCAGGGCAACGGGGTCTTGCTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCG
HKR184027 ARi60B03 pGCAP10 NM_001033002.2  
GGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCACGCCGCTCC
HKR203347 ARiS008G03 pGCAP10 NM_001033002.2  
GGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCC
HKR260175 ARiS150H07 pGCAP10 NM_001033002.2  
GGTGGCTTTGTCTCCCNCNAANAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCC
HKR326554 RBb16G10 pKA1U5 NM_001033002.2  
ATCCTGTGCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCC
HKR329321 RBb23F01 pGCAP1 NM_001033002.2  
GGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCCCT
HKR330129 RBb25F09 pGCAP1 NM_001033002.2  
GGCCTCCAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGT
HKR335283 RBb38D11 pGCAP1 NM_001033002.2  
GGGCTCTGTGCGCGCCTCCGGGGAACGGGCTCTTGTGGCTTTGATCTCCCGCGAAAAGGA
HKR366433 RBd16B09 pGCAP10 NM_001033002.2  
GGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCC
HKR381725 RBd54F05 pGCAP10 NM_001033002.2  
TTTCGGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCG
HKR382130 RBd55F10 pGCAP10 NM_001033002.2  
GGCCTCCAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGANGANATGGCGGAGTCGT
HKR382952 RBd57G08 pGCAP10 NM_001033002.2  
GAGGGGGTCTGTGCGCGCCTCCAGGGAACGGGTCTTGTGGCNTNNNCTCCCGCGAAGAGG
HKR384411 RBd61A11 pGCAP10 NM_001033002.2  
GGTGCAAAGATGTAAGGTTTTTTGAAACTTGAAATGCATTAATAAATAGACGATTAAATC
HKR384931 RBd62F11 pGCAP10 NM_001033002.2  
GGGCGGCTTTCCCGCCCCCCCCGAGGAGATGGNGCACTCCTCCAGGTCTACCCACCTCTC
HKR388451 RBd71C03 pGCAP10 NM_001033002.2  
GCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGC
HKR398574 RBd96H06 pGCAP10 NM_001033002.2  
GGCCTCCAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGT
HKR420445 RBdS051B21 pGCAP10 NM_001033002.2  
GAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl