Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051B21

Clone ID RBdS051B21
HP ID HP05509
Gene ID 84268
Gene Symbol RPAIN
Protein Name RPA interacting protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001033002.2
Length of RefSeq (bp) 1535
Chromosome 17p13.2
Reference DDBJ accession
UniGene Hs.462086
5'-terminal sequence GAGGGAACGGGTCTTGTGGCTTTGTCTCCCGCGAAGAGGAGATGGCGGAGTCGTTGAGGT
2011.08.28