Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05094

HP ID(1) HP05094
Gene ID(2) 56475
Gene Symbol finder RPRM
Protein Name reprimo, TP53 dependant G2 arrest mediator candidate
RefSeq NM_019845.2
Length of RefSeq (bp) 1496
Chromosome 2q23.3
Reference DDBJ accession
UniGene Hs.100890

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe34D04 pKA1U5 TGAAGAGCCTAGCTGCTGCGCGCGTCGGAGAGGCTCCTGGGAAACTCCCACGGCCCAGGG
ARe80H04 pKA1U5 GGCCGGGAACGAGCACCACCAGGGCTGGAGCGGACGGCTTTAGAAGAGCCTAGCTGCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl