Prev. |  KEGG KO K10128 > 

RIKEN DNA Bank Human Resource - RPRM

Gene ID NCBI Gene 56475 |  KEGG hsa:56475
Gene Symbol RPRM
Protein Name reprimo, TP53 dependent G2 arrest mediator homolog
Synonyms REPRIMO
Ortholog resource in our bank

  RPRM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07409 pGL4-phRPRM Promoter collection, Human RPRM promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086347 IRAL015O11 pOTB7 BC002908 NM_019845 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053676 ARe34D04 pKA1U5 NM_019845.2  
TGAAGAGCCTAGCTGCTGCGCGCGTCGGAGAGGCTCCTGGGAAACTCCCACGGCCCAGGG
HKR072172 ARe80H04 pKA1U5 NM_019845.2  
GGCCGGGAACGAGCACCACCAGGGCTGGAGCGGACGGCTTTAGAAGAGCCTAGCTGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl