Prev. |  Human A to Z list >  R >  RPRM > 

ARe34D04 - NRCD Human cDNA Clone

Catalog Number HKR053676
Clone Name ARe34D04
Clone info. Plasmid clone of human RPRM cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) TGAAGAGCCTAGCTGCTGCGCGCGTCGGAGAGGCTCCTGGGAAACTCCCACGGCCCAGGG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_019845.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) RPRM (NCBI Gene 56475)  other clone of RPRM in our bank
Synonyms REPRIMO
Protein Name reprimo, TP53 dependent G2 arrest mediator homolog
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR053676 ARe34D04 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARe34D04 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR053676).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.02

NRCDhumcloneList_AR_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl