Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04886

HP ID(1) HP04886
Gene ID(2) 23623
Gene Symbol finder RUSC1
Protein Name RUN and SH3 domain containing 1
RefSeq NM_014328.3
Length of RefSeq (bp) 2078
Chromosome 1q21-q22
Reference DDBJ accession
UniGene Hs.226499

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe17E06 pKA1U5 GACAGGGAACCGGGATGGGGCTGGGGGACAGCGAGTGCTGGGAAGTGTGCGAGATTTCAC
RBb35F11 pGCAP1 AAGCTCCCCGCGCCCCGTCCTCTCCCGCCCTACAGGCCCTAGCAGGGCAGGCGGGAGGTG
RBdS156A03 pGCAP10 GGCGCCCCGTCCTCTCCCGCCCTACAGGCCCTAGCAGGGCAGGCGGGAGGTGAGCGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl