Prev. | 

RIKEN DNA Bank Human Resource - RUSC1

Gene ID NCBI Gene 23623 |  KEGG hsa:23623
Gene Symbol RUSC1
Protein Name RUN and SH3 domain containing 1
Synonyms NESCA
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX024866 IRAK062C18 pCMV-SPORT6 BC028055 NM_014328 Partial
HGY083121 IRAL007N09 pOTB7 BC001045 NM_014328 Full
HGY085437 IRAL013J21 pOTB7 BC004293 NM_014328 Partial/var
HGY098834 IRAL047B10 pOTB7 BC052277 NM_014328 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046902 ARe17E06 pKA1U5 NM_014328.3  
GACAGGGAACCGGGATGGGGCTGGGGGACAGCGAGTGCTGGGAAGTGTGCGAGATTTCAC
HKR334131 RBb35F11 pGCAP1 NM_014328.3  
AAGCTCCCCGCGCCCCGTCCTCTCCCGCCCTACAGGCCCTAGCAGGGCAGGCGGGAGGTG
HKR462403 RBdS156A03 pGCAP10 NM_014328.3  
GGCGCCCCGTCCTCTCCCGCCCTACAGGCCCTAGCAGGGCAGGCGGGAGGTGAGCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl