Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156A03

Clone ID RBdS156A03
HP ID HP04886
Gene ID 23623
Gene Symbol RUSC1
Protein Name RUN and SH3 domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014328.3
Length of RefSeq (bp) 2078
Chromosome 1q21-q22
Reference DDBJ accession
UniGene Hs.226499
5'-terminal sequence GGCGCCCCGTCCTCTCCCGCCCTACAGGCCCTAGCAGGGCAGGCGGGAGGTGAGCGCGGC
2011.08.28