Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04825

HP ID(1) HP04825
Gene ID(2) 10928
Gene Symbol finder RALBP1
Protein Name ralA binding protein 1
RefSeq NM_006788.3
Length of RefSeq (bp) 4368
Chromosome 18p11.3
Reference DDBJ accession
UniGene Hs.719181

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13D03 pKA1U5 GGAGGCTGGGCGGGGTGGGAATGGGGCGCCCGAGGCCGGCCTGGGGCGCAGCGCAGGAGG
ARiS122J09 pGCAP10 GAAAACAGGCAGAGGCTGGGCGGGGTGGGAATGGGGCGCCCGAGGCCGGCCTGGGGCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl