Prev. |  KEGG KO K08773 > 

RIKEN DNA Bank Human Resource - RALBP1

Gene ID NCBI Gene 10928 |  KEGG hsa:10928
Gene Symbol RALBP1
Protein Name ralA binding protein 1
Synonyms RIP1|RLIP1|RLIP76
Ortholog resource in our bank

  RALBP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045275 ARe13D03 pKA1U5 NM_006788.3  
GGAGGCTGGGCGGGGTGGGAATGGGGCGCCCGAGGCCGGCCTGGGGCGCAGCGCAGGAGG
HKR249025 ARiS122J09 pGCAP10 NM_006788.3 done
GAAAACAGGCAGAGGCTGGGCGGGGTGGGAATGGGGCGCCCGAGGCCGGCCTGGGGCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl