ARiS122J09 - NRCD Human cDNA Clone

Catalog Number HKR249025 Clone Name ARiS122J09 Clone info. Plasmid clone of human RALBP1 cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) GAAAACAGGCAGAGGCTGGGCGGGGTGGGAATGGGGCGCCCGAGGCCGGCCTGGGGCGCA Sequence, submitted(3) n.a.   Sequence, refered NM_006788.3 (NCBI RefSeq mRNA) Gene Symbol and ID(4) RALBP1 (NCBI Gene 10928)  other clone of RALBP1 in our bank Synonyms RIP1|RLIP1|RLIP76 Protein Name ralA binding protein 1

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

References and tips

Featured content

Reference

2023.05.02