Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04781

HP ID(1) HP04781
Gene ID(2) 84153
Gene Symbol finder RNASEH2C
Protein Name ribonuclease H2, subunit C
RefSeq NM_032193.3
Length of RefSeq (bp) 2785
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.718438

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe10H03 pKA1U5 GGTGGGTCCTGCCTGAGGCCCTTTGCGCCTCCCGCTCCAGGACTCGAAGTGTCGTTTCGG
ARe42C10 pKA1U5 GGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGATGGAGAGCGGCGACGAAGCGG
ARe92H04 pKA1U5 GGTCCGGAGGTGGCGGGAGGGCAGCTCCGGGCTCGACCCAGCGTGGGTCCTGCCTGAGGC
ARi71A12 pGCAP10 GAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGATGGAGAGCGGCGACGAAG
RBb02C07 pKA1U5 GGCTTTCCGCGCCAGCTTCAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGA
RBd19F11 pGCAP10 GAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGATGGAGAGCGGCGACGAAG
RBdS154H19 pGCAP10 GGCTTTCCGCGCCAGCTTCAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl