Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RNASEH2C

Gene ID (NCBI) 84153
Gene Symbol RNASEH2C
Protein Name ribonuclease H2, subunit C
Synonyms AGS3|AYP1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10745)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY093464 IRAL033K24 pOTB7 BC023588 NM_032193 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044171 ARe10H03 pKA1U5 NM_032193.3  
GGTGGGTCCTGCCTGAGGCCCTTTGCGCCTCCCGCTCCAGGACTCGAAGTGTCGTTTCGG
HKR056858 ARe42C10 pKA1U5 NM_032193.3  
GGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGATGGAGAGCGGCGACGAAGCGG
HKR188412 ARi71A12 pGCAP10 NM_032193.3  
GAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGATGGAGAGCGGCGACGAAG
HKR076972 ARe92H04 pKA1U5 NM_032193.3  
GGTCCGGAGGTGGCGGGAGGGCAGCTCCGGGCTCGACCCAGCGTGGGTCCTGCCTGAGGC
HKR320855 RBb02C07 pKA1U5 NM_032193.3  
GGCTTTCCGCGCCAGCTTCAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGA
HKR367731 RBd19F11 pGCAP10 NM_032193.3  
GAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGATGGAGAGCGGCGACGAAG
HKR461787 RBdS154H19 pGCAP10 NM_032193.3  
GGCTTTCCGCGCCAGCTTCAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl