Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154H19

Clone ID RBdS154H19
HP ID HP04781
Gene ID 84153
Gene Symbol RNASEH2C
Protein Name ribonuclease H2, subunit C
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032193.3
Length of RefSeq (bp) 2785
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.718438
5'-terminal sequence GGCTTTCCGCGCCAGCTTCAGTGTCAGCTCGCGAGCCCTGGCGTCGCGTAGGAGGGAGGA
2011.08.28