Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04471

HP ID(1) HP04471
Gene ID(2) 6240
Gene Symbol finder RRM1
Protein Name ribonucleotide reductase M1 polypeptide
RefSeq NM_001033.3
Length of RefSeq (bp) 3234
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.445705

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13H12 pKA1U5 GCCCTTTGTGCGTCACGGGTGGCGGGCGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGC
ARi56F05 pGCAP10 GGTGCGTCACGGGTGGCGGGCGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGCTCTGAA
ARi67A02 pGCAP10 GACGGGTGGCGGGCGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGCTCTGAAGAAAGTG
ARiS118K03 pGCAP10 GGTTGCNCCTCTGCTCTGAAGAAAGTGCTGTCTGGCTCCAACTCCAGTTCTTTCCCCTGA
RBb35C08 pGCAP1 TGGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGCTCTGAAGAAAGTGCTGTCTGGCTCC
RBd40C10 pGCAP10 GACCCTTCCCACTCTGTCACCTTCTCGATCCCGCCGGCGCTTTAGAGCCGCAGTCCAGTC
RBd49G11 pGCAP10 TTGGGATTGTTGCGCCTCTGCTCTGAAGAAAGTGCTGTCTGGCTCCAACTCCAGTTCTTT
RBdS154L17 pGCAP10 GGCCCAGACTCAACATGGCGGCTACACGTCGCCTGTCAGTCTGTGAAGCCTACCCCGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl