Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154L17

Clone ID RBdS154L17
HP ID HP04471
Gene ID 6240
Gene Symbol RRM1
Protein Name ribonucleotide reductase M1 polypeptide
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001033.3
Length of RefSeq (bp) 3234
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.445705
5'-terminal sequence GGCCCAGACTCAACATGGCGGCTACACGTCGCCTGTCAGTCTGTGAAGCCTACCCCGGGC
2011.08.28