Prev. |  KEGG KO K10807 > 

RIKEN DNA Bank Human Resource - RRM1

Gene ID NCBI Gene 6240 |  KEGG hsa:6240
Gene Symbol RRM1
Protein Name ribonucleotide reductase catalytic subunit M1
Synonyms R1|RIR1|RR1
Ortholog resources KEGG ortholog (KEGG orthology K10807) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081258 IRAL003C10 pOTB7 BC006498 NM_001033 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045380 ARe13H12 pKA1U5 NM_001033.3  
GCCCTTTGTGCGTCACGGGTGGCGGGCGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGC
HKR182525 ARi56F05 pGCAP10 NM_001033.3  
GGTGCGTCACGGGTGGCGGGCGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGCTCTGAA
HKR186802 ARi67A02 pGCAP10 NM_001033.3  
GACGGGTGGCGGGCGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGCTCTGAAGAAAGTG
HKR247443 ARiS118K03 pGCAP10 NM_001033.3  
GGTTGCNCCTCTGCTCTGAAGAAAGTGCTGTCTGGCTCCAACTCCAGTTCTTTCCCCTGA
HKR334056 RBb35C08 pGCAP1 NM_001033.3  
TGGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGCTCTGAAGAAAGTGCTGTCTGGCTCC
HKR376058 RBd40C10 pGCAP10 NM_001033.3  
GACCCTTCCCACTCTGTCACCTTCTCGATCCCGCCGGCGCTTTAGAGCCGCAGTCCAGTC
HKR379755 RBd49G11 pGCAP10 NM_001033.3  
TTGGGATTGTTGCGCCTCTGCTCTGAAGAAAGTGCTGTCTGGCTCCAACTCCAGTTCTTT
HKR461881 RBdS154L17 pGCAP10 NM_001033.3  
GGCCCAGACTCAACATGGCGGCTACACGTCGCCTGTCAGTCTGTGAAGCCTACCCCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl