Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04280

HP ID(1) HP04280
Gene ID(2) 28956
Gene Symbol finder ROBLD3
Protein Name roadblock domain containing 3
RefSeq NM_014017.2
Length of RefSeq (bp) 644
Chromosome 1q22
Reference DDBJ accession
UniGene Hs.632483

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa00E15 pKA1U5 GACAATAGCCAGGCGAAGAAACTACAACTCCCAGGGCGTCCCGGAGCAGGCCAACGGGAC
RBd38A03 pGCAP10 TGTGCCTCCCCTACCCCGGGAANTTGTTGGACGCTTCCCGCGTAAGGTACC
RBd38B03 pGCAP10 GAGGCCAACGGGACTACGGGAAGCAGCGGGCAGCGGCCCGCGGGAGGCACCTCGGAGATC
RBdS015G24 pGCAP10 GGGGAAGCAGCGGGCAGCGGCCCGCGGGAGGCACCTCGGAGATCTGGGTGCAAAAGCCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl