Prev. |  KEGG KO K20398 > 

RIKEN DNA Bank Human Resource - LAMTOR2

Gene ID NCBI Gene 28956 |  KEGG hsa:28956
Gene Symbol LAMTOR2
Protein Name late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Synonyms ENDAP|HSPC003|MAPBPIP|MAPKSP1AP|ROBLD3|Ragulator2|p14
Ortholog resources KEGG ortholog (KEGG orthology K20398) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081095 IRAL002M07 pOTB7 BC024190 NM_014017 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR000111 ARa00E15 pKA1U5 NM_014017.2  
GACAATAGCCAGGCGAAGAAACTACAACTCCCAGGGCGTCCCGGAGCAGGCCAACGGGAC
HKR375203 RBd38A03 pGCAP10 NM_014017.2  
TGTGCCTCCCCTACCCCGGGAANTTGTTGGACGCTTCCCGCGTAAGGTACC
HKR375227 RBd38B03 pGCAP10 NM_014017.2  
GAGGCCAACGGGACTACGGGAAGCAGCGGGCAGCGGCCCGCGGGAGGCACCTCGGAGATC
HKR406168 RBdS015G24 pGCAP10 NM_014017.2  
GGGGAAGCAGCGGGCAGCGGCCCGCGGGAGGCACCTCGGAGATCTGGGTGCAAAAGCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl