Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015G24

Clone ID RBdS015G24
HP ID HP04280
Gene ID 28956
Gene Symbol ROBLD3
Protein Name roadblock domain containing 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014017.2
Length of RefSeq (bp) 644
Chromosome 1q22
Reference DDBJ accession
UniGene Hs.632483
5'-terminal sequence GGGGAAGCAGCGGGCAGCGGCCCGCGGGAGGCACCTCGGAGATCTGGGTGCAAAAGCCCA
2011.08.28