Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03753

HP ID(1) HP03753
Gene ID(2) 6118
Gene Symbol finder RPA2
Protein Name replication protein A2, 32kDa
RefSeq NM_002946.3
Length of RefSeq (bp) 1741
Chromosome 1p35
Reference DDBJ accession
UniGene Hs.79411

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06H01 pKA1U5 GGCGGGAAGGCGTTTTGTGGTGCCAGAGAAAAGTAGCCAGAGCGGCGCAGTGGCGGCCGC
RBdS105G17 pGCAP10 GGTTTGTGGTGCCAGAGAAAAGTAGCCAGAGCGGCGCAGTGGCGGCCGCGTTCTGTGGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl