Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105G17

Clone ID RBdS105G17
HP ID HP03753
Gene ID 6118
Gene Symbol RPA2
Protein Name replication protein A2, 32kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002946.3
Length of RefSeq (bp) 1741
Chromosome 1p35
Reference DDBJ accession
UniGene Hs.79411
5'-terminal sequence GGTTTGTGGTGCCAGAGAAAAGTAGCCAGAGCGGCGCAGTGGCGGCCGCGTTCTGTGGTT
2011.08.28