Prev. |  KEGG KO K10739 > 

RIKEN DNA Bank Human Resource - RPA2

Gene ID NCBI Gene 6118 |  KEGG hsa:6118
Gene Symbol RPA2
Protein Name replication protein A2
Synonyms REPA2|RP-A p32|RP-A p34|RPA32
Featured content DNA repair (human)
Ortholog resource in our bank

  RPA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083389 IRAL008H21 pOTB7 BC001630 NM_002946 Full
HGY091754 IRAL029G10 pOTB7 BC012157 NM_002946 Full
HGY095649 IRAL039C01 pOTB7 BC021257 NM_002946

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005553 W01A013O17 pENTR-TOPO IRAL039C01 BC021257 NM_002946  
HGE005557 W01A013O21 pENTR-TOPO IRAL039C01 BC021257 NM_002946  
HGE017700 W01A044E04 pENTR-TOPO IRAL008H21 BC001630 NM_002946  
HGE017702 W01A044E06 pENTR-TOPO IRAL008H21 BC001630 NM_002946  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042569 ARe06H01 pKA1U5 NM_002946.3  
GGCGGGAAGGCGTTTTGTGGTGCCAGAGAAAAGTAGCCAGAGCGGCGCAGTGGCGGCCGC
HKR442161 RBdS105G17 pGCAP10 NM_002946.3  
GGTTTGTGGTGCCAGAGAAAAGTAGCCAGAGCGGCGCAGTGGCGGCCGCGTTCTGTGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl