Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03671

HP ID(1) HP03671
Gene ID(2) 9921
Gene Symbol finder RNF10
Protein Name ring finger protein 10
RefSeq NM_014868.4
Length of RefSeq (bp) 3864
Chromosome 12q24.31
Reference DDBJ accession
UniGene Hs.442798

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe51E10 pKA1U5 GGCTGTTTGGCGACTCGATCGCCATTCCCGGAGCAGGTCGGCCTCGGCCCAGGGGCGAGT
ARi59A10 pGCAP10 GGATGCTGTTTGGCGACTCGTCGCCATTCCCGGAGCAGGTCGGCCTCGGCCCAGGGGCGA
RBd25H09 pGCAP10
RBdS081L08 pGCAP10 GGCTGTTTGGCGACTCGTCGCCATTCCCGGAGCAGGTCGGCCTCGGCCCAGGGGCGAGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl