Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081L08

Clone ID RBdS081L08
HP ID HP03671
Gene ID 9921
Gene Symbol RNF10
Protein Name ring finger protein 10
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014868.4
Length of RefSeq (bp) 3864
Chromosome 12q24.31
Reference DDBJ accession
UniGene Hs.442798
5'-terminal sequence GGCTGTTTGGCGACTCGTCGCCATTCCCGGAGCAGGTCGGCCTCGGCCCAGGGGCGAGTA
2011.08.28