Prev. | 

RIKEN DNA Bank Human Resource - RNF10

Gene ID NCBI Gene 9921 |  KEGG hsa:9921
Gene Symbol RNF10
Protein Name ring finger protein 10
Synonyms RIE2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005515 IRAK013N03 pCMV-SPORT6 BC016622 NM_014868 Full
HGX020741 IRAK051O05 pCMV-SPORT6 BC031596 NM_014868 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060506 ARe51E10 pKA1U5 NM_014868.4  
GGCTGTTTGGCGACTCGATCGCCATTCCCGGAGCAGGTCGGCCTCGGCCCAGGGGCGAGT
HKR183610 ARi59A10 pGCAP10 NM_014868.4  
GGATGCTGTTTGGCGACTCGTCGCCATTCCCGGAGCAGGTCGGCCTCGGCCCAGGGGCGA
HKR370177 RBd25H09 pGCAP10 NM_014868.4  
HKR432672 RBdS081L08 pGCAP10 NM_014868.4  
GGCTGTTTGGCGACTCGTCGCCATTCCCGGAGCAGGTCGGCCTCGGCCCAGGGGCGAGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl