Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03616

HP ID(1) HP03616
Gene ID(2) 10856
Gene Symbol finder RUVBL2
Protein Name RuvB-like 2 (E. coli)
RefSeq NM_006666.1
Length of RefSeq (bp) 1488
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.515846

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe33C03 pKA1U5 GGGCAGTTGGTGAGCATCATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGT
ARi67H03 pGCAP10 GGAGCATCATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGTGATGTAACAA
ARiS191E02 pGCAP10 GCCGCTAGGACTCTGGCAGTTGGTGAGCATCATGGCAACCGTTACAGCCACAACCAAAGT
RBd85B09 pGCAP10 GGGTGAGCATCATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGTGATGTAA
RBd85C10 pGCAP10
RBdS040H02 pGCAP10 GAGTTGGTGAGCATCATGGCAACCGTTCCAGGTGTGGTGGTGCAGGCCTGTAATCCCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl