Prev. |  KEGG KO K11338 > 

RIKEN DNA Bank Human Resource - RUVBL2

Gene ID NCBI Gene 10856 |  KEGG hsa:10856
Gene Symbol RUVBL2
Protein Name RuvB like AAA ATPase 2
Synonyms CGI-46|ECP-51|ECP51|INO80J|REPTIN|RVB2|TAP54-beta|TIH2|TIP48|TIP49B
Ortholog resource in our bank

  RUVBL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080433 IRAL001B09 pOTB7 BC000428 -
HGY081863 IRAL004K23 pOTB7 BC004531 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018526 W01A046F06 pENTR-TOPO IRAL001B09 BC000428 -  
HGE018528 W01A046F08 pENTR-TOPO IRAL001B09 BC000428 -  
HGE018532 W01A046F12 pENTR-TOPO IRAL001B09 BC000428 -  
HGE018538 W01A046F18 pENTR-TOPO IRAL001B09 BC000428 -  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053251 ARe33C03 pKA1U5 NM_006666.1  
GGGCAGTTGGTGAGCATCATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGT
HKR186971 ARi67H03 pGCAP10 NM_006666.1  
GGAGCATCATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGTGATGTAACAA
HKR276498 ARiS191E02 pGCAP10 NM_006666.1  
GCCGCTAGGACTCTGGCAGTTGGTGAGCATCATGGCAACCGTTACAGCCACAACCAAAGT
HKR394033 RBd85B09 pGCAP10 NM_006666.1  
GGGTGAGCATCATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGTGATGTAA
HKR394058 RBd85C10 pGCAP10 NM_006666.1  
HKR416170 RBdS040H02 pGCAP10 NM_006666.1  
GAGTTGGTGAGCATCATGGCAACCGTTCCAGGTGTGGTGGTGCAGGCCTGTAATCCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl