Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040H02

Clone ID RBdS040H02
HP ID HP03616
Gene ID 10856
Gene Symbol RUVBL2
Protein Name RuvB-like 2 (E. coli)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006666.1
Length of RefSeq (bp) 1488
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.515846
5'-terminal sequence GAGTTGGTGAGCATCATGGCAACCGTTCCAGGTGTGGTGGTGCAGGCCTGTAATCCCAGC
2011.08.28